kiDNApped (A Tara Shores Thriller) (25 page)

“Let’s swim in a little farther,” he said. The rag-tag team made their way slowly toward the beach. Fifteen minutes later Lance called out from his place in the lead.

“Here. We can get up.” He swam toward the rocks.

“Careful,” Dave warned, but as he approached he could see that Lance was right. A break in the rocks led to a large but shallow tide pool area which in turn led to a narrow rock ledge that could be walked. Evidence of abandoned fishing gear—buckets, beer cans, snarls of monofilament line—was testament to its accessibility from the beach.

“Time the swells—wait ‘til after it comes back out of the cut,” Dave said.

Then they swam as fast as they could into the tide pool, scrambling up onto the rocks before the surge railroaded back through. Kristen and Tara were first to scamper up onto the narrow ledge, seeking shelter from the pounding surf. Dave and Lance followed suit. Soaking wet, they rested for a moment, looking out over the bay. The Duck boat honked its horn, the captain waving at them as he steered the ungainly vehicle outside of the bay.

After a few minutes, Dave took the lead and they began picking their way single file along the ledge toward the beach.

 
Kristen flopped onto the sand, exhausted, feeling sharp bits of shell and fragmented coral jabbing her skin, but grateful just to be here. Dave and Lance followed suit. Only Tara remained on her feet, resting her hands on her knees like a distance runner taking a break. Glad to be free of the water, she surveyed their surroundings.

They were situated at the far end of Hanauma Bay, a good half-mile from the opposite end of the beach where it was hard to see the sand between tourist beach towels, and trams carried beachgoers up and down from the visitor center on a steep, paved grade. A handholding couple strolled perhaps fifty yards away, while a lone snorkeler escaping the finned throngs further down the beach kicked along after a parrotfish on the nearby inshore reef.

Wary, the bedraggled group kept watch for any suspicious characters down the beach. They saw none. The tropical sun began to dry them in short order.

“So what’s our game plan?” Lance asked, mustering the energy to stand and remove his shirt, hanging it on a nearby bush to dry. Beyond the beach, a rugged landscape of thick vegetation extended back to meet a cliff wall. They could hear occasional crackling through the underbrush—mongoose, lizards and birds.

“I think we’re safe here for now,” Tara said. “I don’t think you should go right back to Dave’s house. Or your hotel.”

“Agreed,” Kristen said, reaching for the backpack, which appeared to be mostly dry.

“So, what—we’re just gonna camp out on the beach forever?” Lance said.

“Lance,” Kristen said, “I will remind you that it was you who got us into this mess. So whatever we’re gonna do, you’re gonna go along with it.”

“Right,” Lance said, tossing a pebble at a mongoose in the bushes.

Kristen removed her laptop from the pack. She brushed a few water drops from the laptop’s case, then powered the computer on.

“Lance, you and I obviously have some issues to work through. But for now—until we get Dad back—we are going to need to work together. So I’m not going to remind you anymore of what you did, okay? Because I need you—Dad needs you. But you should also know that when this is all over—you
will
have a price to pay. I don’t know what it will be, but you and you alone will have to come to terms with it.”

Tara said nothing but silently agreed. She would have to arrest Lance at some point, but for now she was still building evidence against Lance, and she needed him in order to track down the kidnappers. As long as he stayed in her direct line of sight, she wouldn’t bring him in just yet.

Lance turned around, letting the handful of pebbles in his hand drop back to the sand. “I know I screwed up,” he said. “But I’m here to make it right, as best I can. That’s all I can do.”

Tara nodded. “Let’s come up with a plan,” she said.
Lance realizes that his cooperation will make things go easier on him when he is charged
.

Kristen said, “I think we should stay here long enough to see if we’ve got another message from Dad. Dave, maybe—”

Tara cut in. “Wait a minute,
what
?”

“I forgot to tell you,” Kristen said. She explained to Tara how she’d connected via the coffee shop’s Wi-Fi and downloaded the sequencing lab file.

Tara was irked that Kristen had done this without telling her, because she could have summoned help from the F.O. But what’s done is done, Tara thought, and if there was a message from William Archer, that would constitute a tremendous break in the actual kidnapping case.

“I was only connected for a few seconds,” Kristen said, reading her mind. She went on, “Lance, just stand by and stay out of trouble. I may have a job for you.”

She squinted at the screen in the brilliant sunlight. It soon became apparent that it was too bright to read the screen.

“You’ll probably have to duck under that tree to get some shade,” Dave said. He took off his shirt and walked over to a stunted, bush-like tree at the edge of the beach. He stretched the shirt over some branches. He grabbed Lance’s and did the same, forming a crude cover. “Under here,” he said, waving Kristen over. She took the laptop and hunkered down under the bush, sitting cross-legged on the dirt.

“Much better,” she called out, angling the screen. She opened the lab file she had downloaded earlier during her wireless drive-by. Another plain format DNA sequence file, this one a DNA panel for the bioluminescent marine bacterium Kristen and Dave had recovered from the mason jar in the lab.
Tropic Sequence’s
flooded

Kristen searched for the START sequence gleaned from the decryption file on the flash drive.

Match.

She repeated the process for the STOP string.

Match!

An uncontrollable shiver travelled down her spine. Another message from her father resided within the symbols on her screen, waiting to be unscrambled.

…CGAA
46
CGAA...

11:06 A.M.

“Two guys coming our way,” Kristen heard Tara warn. A rush of adrenaline stabbed at her abdomen. She started to close the laptop, ready to run, but then Tara spoke again.

“It’s okay. Just two gay guys, it looks like, taking a stroll away from the crowd. Keep working,” Tara said. Lance chuckled.

Kristen took a deep breath before returning her attention to the screen. She remembered how long it had taken her to decode the first message, sitting there in Dave’s living room, transcribing symbol after symbol. She wasn’t looking forward to repeating the cumbersome process.

“Okay, Lance,” she called out, “I’ve got a job for you that will go toward redeeming yourself.”

She heard him reply from somewhere nearby on the sand. “What is it?”

“A programming job.”

“Go help her,” Tara said. Then Kristen heard the crackle of footsteps, saw the tree branches shake, and then her brother squatted down next to her in front of the computer.

“What have you got?” he asked.

Kristen explained to him the decryption file from the flash drive, and how it worked with the DNA sequence from the lab. “So we know there’s a message deliberately encoded into this DNA sequence,” she finished.

“But last time you manually decoded it, and this time you want me to write a program that automatically parses the file, comparing it to the decrypt key, and writing the translation results to an output file,” Lance said.

Kristen smiled. “Exactly. I’ll leave you to it. Batteries won’t last long, so speed is of the essence.”

“I’m on it,” Lance said. He considered the screen as Kristen parted branches and stepped back out to the beach:

GCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCC GCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCACCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCAC CAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCAAGCTCGGGAGGTGGCCAGGCGCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTCCCCAGCAATCCGCGCGCCGGGACAGAATGCCAAGCTCGTTTGGGACCTATATATCCGTTTAAGTTTTTGAATTACAGACCTGAATTACAGACCTGAATTACAGACCTGAATTGAACACATG...

Lance stared at the mind-numbing string of biochemical symbols as his sister had done two days earlier. On and on for ten pages the symbols went. But unlike his sister, he considered the information not from a genetic perspective, but from an automation standpoint. The manual steps Kristen had taken to decode the message contained within the bacterium’s genome were an algorithm, Dave knew—an ordered series of steps—and algorithms could be automated by writing computer code.

In fact, Lance thought as he looked at a diagram Kristen had used to illustrate the decoding steps, it was a relatively simple algorithm. While the underlying concept itself was a sophisticated cross-disciplinary breakthrough, the message decryption procedure could be done using a simple scripting language.

Lance opened a new text file. He set to work writing a script, occasionally pausing to brush bits of plant matter from the keyboard or to smear an insect that dared land on his screen. His broken finger made typing awkward. He could hear Dave and Kristen chatting out on the sand, but he tuned out their presence, focusing on translating Kristen’s decoding process into something the computer could understand. He occasionally paused to wipe sweat from his brow. He was surprised when, nearly forty minutes later, he reached the end of his script and saw how much time had passed.

Taking a deep breath, he executed his new script.

Not that he expected it to work the first time through. He anticipated errors, and there were some. The debugging process was an essential part of programming. But he could see where it was hanging up, and quickly corrected the code. Simple typo’s were responsible in a couple of instances, the result of rapid coding under immense pressure to succeed.

The next time he ran the program, Lance was so pleased to see recognizable English language materialize in the output file that at first he didn’t grasp the meaning of the words.

But as he stared at them, he knew he had done it. His script had automatically processed the genetic letters, comparing thousands of them per second to the patterns in the decryption key, extracting their cryptic message.

And what a message it was.

He yelled for Kristen, Dave and Tara.

…GAAA
47
CGCC...

11:45 A.M.

“You have the message?” Kristen asked, ducking under the bush. Tara was right behind her while Dave guarded the beach. Lance nodded, angling the laptop’s screen to give them a clear view:

boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa…

“Boat Nahoa,” Kristen said, reading aloud. “And what’s that number? The boat registration number?”

Tara shook her head. “No. Not in Hawaii, anyway.
Nahoa
, that’s obviously Hawaiian, but a Hawaii boat tag would start with the letters HA, which is different from the two-letter state abbreviation of HI.”

“What about the CH?” Lance asked.

“I don’t think there’s any state with the marine abbreviation CH,” Tara said.

“Maybe another country...China?” Kristen suggested.

“I don’t know, but I don’t think there’s too many Chinese boats around here. And why would a Chinese boat be named in Hawaiian?” Dave said.

“Lots of Chinese people live in Hawaii,” Tara stated.

“We should Google this number, and
Nahoa
,” Kristen said, reaching for the laptop’s wireless switch.

“There won’t be a signal down here,” Tara said, before adding, “Maybe in the visitor center up on the cliff at the entrance, but definitely not down here.”

Kristen tried it anyway.

No signal.

“He’s trying to say he’s being held on a boat called the
Nahoa
,” Lance said. “I don’t know what that number is either, but it does say ‘
and’
between the boat name and the number, like maybe they’re not related.”

“He is supposed to be on a boat, probably a large yacht,” Lance continued. “But these guys were prepared for this in advance. The boat name Dad saw painted on the hull might not be the real registered name. Probably isn’t.”

“It’s still something solid to go on,” Tara said. “Registered or not, if that name is painted on the boat, people might have seen it. It can be found.”

“True,” Lance said. “It’s not something they’d want anyone to know. Hell, they wanted us dead already, just because we found the
Tropic Sequence
.”

“It’s a twenty-one digit number,” Kristen stated, moving on with the puzzle. They stared at it for a second and then Tara exited the bushes, saying, “We’ve been as productive as we can be here. We need to go online and find out what kind of things are associated with twenty-one digit numbers,” she said as she made her way back out to the beach. “And look up the boat name.”

Kristen snapped the laptop shut and stood.

“It’s a pretty long walk down the beach and up the hill to the parking lot,” Tara said, shading her eyes with a hand. “We should get going.”

Part IV: Mutation

…TCCG
48
GGGG...

11:50 A.M.

Dr. William Archer had to admit that his kidnappers had done a meticulous job of replicating his shipboard laboratory. It was identical down to the smallest detail—the layout, the lab equipment, the configuration of the benches, the black reflective tile flooring—even the placement of the glassware and the overhead non-glare fluorescent lighting. All of this made it easy to forget that he was not in his own lab.