Ancient DNA: Methods and Protocols (12 page)

Mdhair12SPCR1Clone3

........................................

Mdhair12SPCR1Clone4

........................................

Mdhair12SPCR2Clone1

........................................

Mdhair12SPCR2Clone2

...................T.....A...T....T.T...

Mdhair12SPCR2Clone3

........................................

Mdhair12SPCR2Clone4

........................................

Mdhair12SPCR3Clone1

......................................T.

Mdhair12SPCR3Clone2

........................................

Mdhair12SPCR3Clone3

........................................

Mdhair12SPCR3Clone4

........................................

Fig. 1. Alignment of four cloned PCR products each from three different amplifi cations of 12S rDNA, originally amplifi ed from a hair shaft belonging to
M. darwinii
that was isolated from a paleofecal sample.

10

20

30

40

50

60

. . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

M.darwinii16S(Höss1996)

CGTAGGACTTTAATCGTTGAACAAACGAACCATCAATAGCGGTTGCGCCATTAGGGTGTC

Mdhair16SPCR1Clone1

............................................................

Mdhair16SPCR1Clone2

............................................................

Mdhair16SPCR1Clone3

............................................................

Mdhair16SPCR1Clone4

............................................................

Mdhair16SPCR2Clone3

............................................................

Mdhair16SPCR2Clone4

......................................................A.....

Mdhair16SPCR3Clone1

.................................T..........................

Mdhair16SPCR3Clone2

............................................................

Mdhair16SPCR3Clone4

............................................................

70

80

90

100

110

. . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . .

M.darwinii16S(Höss1996)

CTGATCCAACATCGAGGTCGTAAACCCTATTGTCGATATGGACTCTGAAATA

Mdhair16SPCR1Clone1

....................................................

Mdhair16SPCR1Clone2

.............T......................................

Mdhair16SPCR1Clone3

....................................................

Mdhair16SPCR1Clone4

....................................................

Mdhair16SPCR2Clone3

.........T................T.........................

Mdhair16SPCR2Clone4

....................................................

Mdhair16SPCR3Clone1

....................................................

Mdhair16SPCR3Clone2

....................................................

Mdhair16SPCR3Clone4

....................................................

Fig. 2. Alignment of two to four cloned PCR products each from three different amplifi cations of 16S rDNA, originally amplifi ed from a hair shaft belonging to
M. darwinii
that was isolated from a paleofecal sample.

7 Case Study: Ancient Sloth DNA Recovered from Hairs Preserved in Paleofeces 55

clone sequence was particularly damaged: 12S PCR2 clone2

(
Fig. 1
) displays seven C to T transitions, two G to A transitions, and a deletion. Given that all damaged sites are the most common type of damage in ancient DNA, it is reasonable to assume that fragment is not an exogenous contaminant, but rather a highly degraded starting template, and perhaps also affected by jumping PCR.

The presence of
M. darwinii
DNA in hair shafts preserved within paleofeces reveals an additional source of ancient DNA for downstream analyses. Paleofeces are comprised of both a broad diversity of processed material and the defecator’s own sloughed
tissue ( 7– 9
) . Separating the constituent materials prior to DNA extraction could facilitate downstream applications, such as targeted sequencing.

Hair shafts, if present in paleofeces, represent macroscopic packets of species-specifi c cells, potentially enriched with mtDNA
( 2 )
and relatively simple to separate, clean, and process. In addition, the gross structure of hair may signifi cantly limit exogenous DNA contamination
( 18 )
. Finally, the relatively simple process of separating and cleaning hair of fecal debris dramatically decreases the potential of coamplifying contaminating sequences from the paleofeces itself, including DNA from the defecator. This could add novel insights into, for example, the diets of carnivores
( 12 )
, or conspecifi c oral grooming behaviors.

References

1. Gilbert MTP, Wilson AS, Bunce M, Hansen

Pääbo S (1998) Molecular coproscopy: dung and

AJ, Willerslev E, Shapiro B, Higham TFG,

diet of the extinct ground sloth
Nothrotheriops

Richards MP, O’Connell TC, Tobin DJ,

shastensis
. Science 281:402–406

Janaway RC, Cooper A (2004) Ancient mito—

8. Poinar HN, Küch M, Sobolik KD, Barnes I,

chondrial DNA from hair. Curr Biol

Stankiewicz AB, Kuder T, Spaulding WG,

14:R463–R464

Bryant VM, Cooper A, Pääbo S (2001) A

2. Gilbert MTP et al (2008) Intraspecifi c phylo—

molecular analysis of dietary diversity for three

genetic analysis of Siberian woolly mammoths

archaic Native Americans. Proc Natl Acad Sci

using complete mitochondrial genomes. Proc

U S A 98:4317–4322

Natl Acad Sci U S A 105:8327–8332

9. Hofreiter M, Betancourt JL, de Sbriller AP,

3. Gilbert MTP et al (2008) Paleo-Eskimo

Markgraf V, McDonald HG (2003) Phylogeny,

mtDNA genome reveals matrilineal disconti—

diet and habitat of an extinct ground sloth

nuity in Greenland. Science 320:1787–1789

from Cuchillo Curá, Neuquén Province, south—

4. Miller W et al (2008) Sequencing the nuclear

west Argentina. Quat Res 59:364–378

genome of the extinct woolly mammoth. 10. Kuch M, Rohland N, Betancourt JL, Latorre Nature 456:387–390

C, Steppan S, Poinar HN (2002) Molecular

5. Rasmussen M et al (2010) Ancient human

analysis of an 11,700-year-old rodent midden

genome sequence of an extinct Palaeo-Eskimo.

from the Atacama Desert, Chile. Mol Ecol

Nature 463:757–762

11:913–924

6. Poinar HN, Kuch M, McDonald G, Martin P,

11. Zhang W, Zhang Z, Xu X, Wei K, Wang X,

Pääbo S (2003) Nuclear gene sequences from a

Liang X, Zhang L, Shen F, Hou R, Yue B

Late Pleistocene sloth coprolite. Curr Biol

(2009) A new method for DNA extraction

13:1150–1152

from FECES and hair shafts of the South China

7. Poinar H, Hofreiter M, Spaulding G, Martin P,

Tiger (

Panthera tigris amoyensis

). Zoo Biol

Stankiewicz A, Bland H, Evershed R, Possnert G,

28:49–58

56

A.A. Clack
et al.

12. Backwell L, Pickering R, Brothwell D, Berger

15. Lindahl T (1993) Instability and decay of the

L, Witcomb M, Martill D, Penkman K, Wilson

primary structure of DNA. Nature 36:709–715

A (2009) Probable human hair found in a fossil

16. Hall TA (1999) BioEdit: a user-friendly bio—

hyaena coprolite from Gladysvale cave, South

logical sequence alignment editor and analysis

Africa. J Archaeol Sci 36:1269–1276

program for Windows 95/98/NT. Nucleic

13. Höss M, Dilling A, Currant A, Päabo S (1996)

Acids Symp Ser 41:95–98

Molecular phylogeny of the extinct ground 17. Gilbert MTP et al (2007) Recharacterization sloth
Mylodon darwinii
. Proc Natl Acad Sci U

of ancient DNA miscoding lesions: insights in

S A 93:181–185

the era of sequencing-by-synthesis. Nucleic

14. Campos PF, Gilbert MTP (2011) DNA extrac—

Acids Res 35:1–10

tion from keratin and chitin. In: Shapiro B, 18. Gilbert MTP, Menez L, Janaway RC, Tobin Hofreiter M (eds) Ancient DNA. Springer,

DJ, Cooper A, Wilson AS (2006) Resistance of

New York

degraded hair shafts to contaminant DNA.

Forensic Sci Int 156:208–212

Ancient DNA Extraction from Soils and Sediments

James Haile

Abstract

DNA contained in soils and sediments can provide novel insights into past environments and ecosystems.

In this chapter, I describe an effi cient and effective technique to extract total DNA from sediments in a manner that minimizes the coextraction of PCR-inhibitory compounds. I describe two different approaches: one that is suitable for large (up to 10 g wet weight) amounts of substrate, and a second that is more appropriate for small (up to 0.5 g) amounts of substrate. Finally, I discuss some of the obstacles that may be encountered in the process of extracting DNA from soils and sediments and suggest approaches to circumvent some common problems.

Key words:
Sediment , Soils , Ancient DNA , Metagenomics , Environmental sampling , SedaDNA 1. Introduction

Sediments and paleosols have proven to be an excellent repository of ancient DNA of plants, fungi, and animals from both arctic and temperate biomes and from tropical and arid environments
( 1– 5 )
.

However, the humic compounds and other organomineral complexes to which the extracellular DNA binds and which protect the DNA from extracellular, micr
obial DNases, and nucleases ( 6, 7
) also inhibit PCR amplifi cation. Therefore, any successful extraction of DNA from sediments will need to remove these substances.

Sediments are heterogeneous with respect to DNA distribution, and a compromise needs to be struck between using large volumes of sample so as to maximize the chance of recovering DNA and the resulting decrease in fi ne, temporal resolution that can occur when large samples are processed. Given this limitation, processing larger amounts of sediment tends to improve the success rate of extracting rare or low-copy number DNA. As large volume samples are not always available, I describe protocols for both large extractions and small extractions below.

Beth Shapiro and Michael Hofreiter (eds.),
Ancient DNA: Methods and Protocols
, Methods in Molecular Biology, vol. 840, DOI 10.1007/978-1-61779-516-9_8, © Springer Science+Business Media, LLC 2012

57

58

J. Haile

For large extractions (up to 10 g wet weight) of sediment, the PowerMaxSoil™ DNA Isolation Kit (Cambio) is recommended.

In this protocol, up to 10 g wet weight of sediment sample is homogenized and cells lysed using a 50-mL tube containing garnet grits and extraction buffer. The lysate is then progressively cleaned of cellular debris by centrifugation and precipitation.

Aqueous molecules coextracted with the DNA are then removed using silica spin columns.

For extractions of up to 0.5 g, a protocol that uses components from FastDNA ® SPIN Kit for Soil for isolation (QBIOgene) is recommended. The soil sample is added to a 2-mL tube that contains glass beads. The tube is then shaken vigorously in the presence of an extraction buffer, to pulverize and lyse the samples. Lipids are removed using chloroform/octanol and the DNA-containing solution cleaned using silica spin columns.

2. Materials

Extraction of sedimentary ancient DNA (
sed
aDNA) should be carried out in a dedicated ancient DNA facility using established protocols
( 8
) .

2.1. Large Extraction

1. 100-m L, 1-mL, and 10-mL pipettes and tips.

2. 1.5-mL tubes (at least one per extract, depending upon fi nal volume eluted).

3. 50-mL tubes (one per sample).

4. Rotary mixer, wheel, or similar device to keep samples constantly in motion during incubation steps, capable of holding 50-mL tubes.

5. Oven large enough to accommodate the rotary mixer.

6. Centrifuge capable of holding 50-mL tubes and reaching a force of 2,500 ×
g.

7. Vortex-Genie ® Vortex and a Vortex Adapter capable of shaking two 50-mL tubes simultaneously (CamBio).

8. Garnet grit: aliquots provided in the PowerMax ® Bead Tubes from the PowerMaxTM DNA Isolation Kit.

9. Bulat
( 9
) extraction buffer: 0.02 g/mL Sarcosyl, 50 mM Tris–HCl (pH 8.0), 20 mM NaCl, 3.5% 2-mercaptoethanol, 50 mM

1,4-Dithio- L -threitol (DTT), 2 mM
N
-phenacylthiazone bromide (PTB), 0.8 g/mL Proteinase K (see Note 1).

10. Solutions C1–C6 from the PowerMaxSoil™ DNA Isolation Kit (Cambio).

11. HPLC grade water.

8 Ancient DNA Extraction from Soils and Sediments

59

2.2. Small Extraction

1. 100-mL and 1-mL pipettes and tips .

(Materials)

2. FastPrep ® Instrument (Qbiogene).

3. FastPrep ® Lysing Matrix E tubes.

4. 1.5-mL tubes (two per sample).

5. Microcentrifuge capable of reaching a force of 12,000 ×
g.

6. Rotary mixer, wheel, or similar device to keep samples constantly in motion during incubation steps, capable of holding 2-mL tubes.

7. Oven large enough to accommodate the rotary mixer.

8. Bulat
( 9 )
extraction buffer : 0.02 g/mL Sarcosyl, 50 mM Tris–HCl (pH 8.0), 20 mM NaCl, 3.5% 2-mercaptoethanol, 50 mM

1,4-Dithio- L -threitol (DTT), 2 mM
N
-phenacylthiazone bromide (PTB), 0.8 g/mL Proteinase K (see Note 1).